olnud (olnud) wrote,
olnud
olnud

Новый класс инфузорий



Почти на днях описан новый класс инфузорий – Cariacotrichea (Orsi et al., 2011. Int J Syst Evol Microbiol) с единственным видом Cariacothrix caudata из подземного сернистого водоема (глубина 900 м) в Венесуэле. Примечательно, что там были и другие близкие виды, но они пока не описаны. Ничего особенного в этой инфузории нет, хотя ее внутреннее строение не изучено. Новый класс установлен на основе молекулярно-генетического анализа, поэтому и диагноз этого таксона соответствующий:
Diagnosis: Small, anaerobic Ciliophora with an archway-shaped kinety surrounding the oral opening and extending to posterior body end; contain a ribosomal RNA gene exhibiting 88% sequence identity with the closest related rRNA sequence from the described species Amphisiella magnigranulosa (GenBank accession number AM412774); contain a unique molecular signature 'GAAACAGUCGGGGGUAUCAGUA' (spanning nucleotide positions 283-305 in GenBank accession number GU819615).

Subscribe

  • Черви «нет»

    Вышла хорошая статья Interstitial Annelida, посвященная наиболее аберрантным полихетам. Интерстициальные (живущие между песчинками или где-то еще,…

  • Черно-белое

    Есть у меня один новый вид немертин из Вьетнама: голова у него полностью черная, а тело – белое. Хотел я его назвать Tetrastemma albonigrum…

  • Преподавательское: онлайн экзаменационное

    Три дня принимал экзамен по зоологии - онлайн. Связь подкачала лишь однажды. Студенты должны были отвечать без подготовки, с включенной камерой.…

  • Post a new comment

    Error

    Anonymous comments are disabled in this journal

    default userpic

    Your reply will be screened

    Your IP address will be recorded 

  • 0 comments