olnud (olnud) wrote,
olnud
olnud

Новый класс инфузорий



Почти на днях описан новый класс инфузорий – Cariacotrichea (Orsi et al., 2011. Int J Syst Evol Microbiol) с единственным видом Cariacothrix caudata из подземного сернистого водоема (глубина 900 м) в Венесуэле. Примечательно, что там были и другие близкие виды, но они пока не описаны. Ничего особенного в этой инфузории нет, хотя ее внутреннее строение не изучено. Новый класс установлен на основе молекулярно-генетического анализа, поэтому и диагноз этого таксона соответствующий:
Diagnosis: Small, anaerobic Ciliophora with an archway-shaped kinety surrounding the oral opening and extending to posterior body end; contain a ribosomal RNA gene exhibiting 88% sequence identity with the closest related rRNA sequence from the described species Amphisiella magnigranulosa (GenBank accession number AM412774); contain a unique molecular signature 'GAAACAGUCGGGGGUAUCAGUA' (spanning nucleotide positions 283-305 in GenBank accession number GU819615).

Subscribe

  • Преподавательское: расписание

    Мой приятель из Москвы прислал эту картинку, а я возьми и похвастайся: у нас расписание уже готово за 10 дней. Оказалось, что и у нас есть…

  • Преподавательское: предсеместровое

    Занятия в ДВФУ начинаются с 13 сентября – спасибо ВЭФ! И отлично, поскольку погода стоит летняя, вода в заливе 22 градуса. Даже в некоторых школах…

  • Кто на свете всех длиннее?

    В этом году в экспедиции около берегов Приморья водолазы собрали самую длинную немертину, которую я ког-либо видел живьем. Собранная на глубине 5…

  • Post a new comment

    Error

    Anonymous comments are disabled in this journal

    default userpic

    Your reply will be screened

    Your IP address will be recorded 

  • 0 comments